| Gene name |
SPBC947.06c |
| Gene ID |
24/C04 |
| Gene synonyms/obsolete |
|
| Gene product |
unknown specificity;
transporter; similar to SpSPAC11D3.05 and SPCC794.04C and
SPCC569.05C and SPBC36.03C and SPBC36.01C and SPBC36.02C and
SPBC530.02 and SPBC530.15c; involved in amine/polyamine
transport; (old->MSF membrane transporter) |
| Entry clone |
Cloned
(Re-cloned) |
| ORF length (unspliced) |
1497 |
| ORF length (spliced) |
|
| Entry clone length |
1497 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC947.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAAAATGATCATTT |
| Rev primer name |
SPBC947.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTGATTAGCTTGATGAAG |
| Amino acid length |
498 |
| Molecular weight |
55.2 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
484/485 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPTCLYILGI |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |