Gene name |
SPCC970.02 |
Gene ID |
24/C06 |
Gene synonyms/obsolete |
|
Gene product |
glycosyl hydrolase
family; alpha-1,6-mannanase; similar to Sp SPAC3C7.05c; GPI
anchored protein; glycoprotein |
Entry clone |
Cloned |
ORF length (unspliced) |
1498 |
ORF length (spliced) |
1329 |
Entry clone length |
1498 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
788A:G / 1071A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC970.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCTTACAATCTTTAT |
Rev primer name |
SPCC970.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTAAAGGACCAGTGTAGGC |
Amino acid length |
442 |
Molecular weight |
49.1 |
Isoelectric point (calc.) |
4.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEAIQAPLLL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |