| Gene name |
SPAC4A8.07c |
| Gene ID |
24/G05 |
| Gene synonyms/obsolete |
|
| Gene product |
diacylglycerol kinase;
involved in sphingolipid metabolism; sphingoid long chain base
(LCB) kinase; similar to S. cerevisiae YOR171C and
YLR260W |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1525 |
| ORF length (spliced) |
1377 |
| Entry clone length |
1525 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4A8.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTCGGTCTTACCAA |
| Rev primer name |
SPAC4A8.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATATCCAACAATTGAAAC |
| Amino acid length |
458 |
| Molecular weight |
51.2 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKPALTALEI/LTFEINDLSI |
| Localization (YFP) |
periphery, especially
at cell tip and site of septum formation; ambiguous
structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |