Gene name |
SPAC4A8.07c |
Gene ID |
24/G05 |
Gene synonyms/obsolete |
|
Gene product |
diacylglycerol kinase;
involved in sphingolipid metabolism; sphingoid long chain base
(LCB) kinase; similar to S. cerevisiae YOR171C and
YLR260W |
Entry clone |
Cloned# |
ORF length (unspliced) |
1525 |
ORF length (spliced) |
1377 |
Entry clone length |
1525 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC4A8.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTCGGTCTTACCAA |
Rev primer name |
SPAC4A8.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATATATCCAACAATTGAAAC |
Amino acid length |
458 |
Molecular weight |
51.2 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKPALTALEI/LTFEINDLSI |
Localization (YFP) |
periphery, especially
at cell tip and site of septum formation; ambiguous
structure |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |