Gene name |
SPBC800.08 |
Gene ID |
24/G06 |
Gene synonyms/obsolete |
|
Gene product |
eukaryotic translation
initiation factor 3 gamma subunit; involved in
1-methyladenosine modification and maturation of initiator
methionyl-tRNA; RNA-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1525 |
ORF length (spliced) |
1389 |
Entry clone length |
1525 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
852A:G / 1260A:G /
1345A:C / 1407T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC800.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGAGGCATGCATCAAC |
Rev primer name |
SPBC800.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTTTCCAATTTTGCTTTT |
Amino acid length |
462 |
Molecular weight |
53.2 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQHLLPKLGI |
Localization (YFP) |
nucleus |
Comments for localization |
one nuclear dot by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |