Gene name |
SPAC222.09 |
Gene ID |
27/F08 |
Gene synonyms/obsolete |
|
Gene product |
involved in the
regulation of transcriptional elongation, 3' end formation;
interacts physically with Rpb7p; RNA-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2053 |
ORF length (spliced) |
1863 |
Entry clone length |
2053 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
182G:A / 1035A:G /
1725A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC222.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGGAATCGCTGAATT |
Rev primer name |
SPAC222.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGGGGTTGCCAAGGAGGT |
Amino acid length |
620 |
Molecular weight |
66.4 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
except nucleolus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |