| Gene name |
SPAC15A10.10 |
| Gene ID |
28/D04 |
| Gene synonyms/obsolete |
mde6 |
| Gene product |
involved in
sporulation; involved in mitosis; Mei4p-dependent expression;
Muskelin homolog; kelch repeat protein; non-essential; no
apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2330 |
| ORF length (spliced) |
2151 |
| Entry clone length |
2330 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC15A10.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACGTAAAGAATTGTC |
| Rev primer name |
SPAC15A10.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTGAAAAATTCAATCATA |
| Amino acid length |
716 |
| Molecular weight |
83.6 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSDFWKLDI/LSNVSLQLHL |
| Localization (YFP) |
a few cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |