Gene name |
SPCC584.05 |
Gene ID |
28/D05 |
Gene synonyms/obsolete |
sec1 |
Gene product |
sec1 family; SNARE
binding activity; SNARE docking complex (TRAPP?); involved in
non-selective vesicle docking; syntaxin binding protein;
involved in intracellular protein transport; involved in
secretory pathway; involved in exocytosis; involved in
non-selective vesicle docking; involved in ER to golgi
transport |
Entry clone |
Cloned |
ORF length (unspliced) |
2336 |
ORF length (spliced) |
2082 |
Entry clone length |
2336 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC584.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACACTGCTGGAGCTCCA |
Rev primer name |
SPCC584.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAAACACCAAAACGCTTC |
Amino acid length |
693 |
Molecular weight |
79.6 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLELQKELFL |
Localization (YFP) |
nucleus>cytosol;
periphery at cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |