| Gene name |
SPCC1259.02c |
| Gene ID |
28/H05 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved protein;
peptidase family M20 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2469 |
| ORF length (spliced) |
|
| Entry clone length |
2469 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
78T:C / 554T:C /
566T:C / 614A:G / 2370T:C / 2430T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1259.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTTAGTTTGTGCTTC |
| Rev primer name |
SPCC1259.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCGAGCTTGAAATTTCCT |
| Amino acid length |
822 |
| Molecular weight |
91.8 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNTLVGGLGI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |