Gene name |
SPBC13E7.01 |
Gene ID |
29/B01 |
Gene synonyms/obsolete |
cwf22;
SPBC15D4.16 |
Gene product |
eukaryotic conserved
protein; MIF4G domain; MA3 domain; complexed with Cdc5p; human
ortholog fSAPb has been isolated with functional spliceosomes
|
Entry clone |
Cloned#/Sequence
mismatch |
ORF length (unspliced) |
2505 |
ORF length (spliced) |
|
Entry clone length |
2505 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2345G:addition |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC13E7.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGAAAGAAGATAAATC |
Rev primer name |
SPBC13E7.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTGGTATGTTTTTTGCTT |
Amino acid length |
834 |
Molecular weight |
96.3 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |