| Gene name |
SPBC776.04 |
| Gene ID |
29/D04 |
| Gene synonyms/obsolete |
sec2302; sec23-b |
| Gene product |
GTPase activator;
involved in intracellular protein transport; COPII-coated
vesicle component; similar to Sp SPCC31H12.07 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2557 |
| ORF length (spliced) |
2298 |
| Entry clone length |
2557 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
124A:G / 1231C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC776.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTTTGAGGACATAGA |
| Rev primer name |
SPBC776.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATATGACAGCCATTTTA |
| Amino acid length |
765 |
| Molecular weight |
85.3 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKDAVIVSLSL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |