| Gene name |
SPAC222.14c |
| Gene ID |
29/D05 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; GTP-binding protein; similarity in the
C-terminal region to human GBP1, an interferon-induced
GTP-binding protein |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2567 |
| ORF length (spliced) |
2289 |
| Entry clone length |
2567 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC222.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTACTGCTTCCAATAG |
| Rev primer name |
SPAC222.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAAGCGCAGTTTTTTCT |
| Amino acid length |
762 |
| Molecular weight |
87.5 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKTVLEVNLQL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to: nuclear
dots; nucleus |
| Microscope used for
observation |
DeltaVision |