Gene name |
SPBC4F6.06 |
Gene ID |
33/H07 |
Gene synonyms/obsolete |
kin1 |
Gene product |
serine/threonine
protein kinase; involved in cell polarity (implicated);
involved in cellular morphogenesis |
Entry clone |
Cloned |
ORF length (unspliced) |
2676 |
ORF length (spliced) |
|
Entry clone length |
2676 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
2211T:C /
2244T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC4F6.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTACCGTACCAATAA |
Rev primer name |
SPBC4F6.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATTTTAATTCGTTAAGA |
Amino acid length |
891 |
Molecular weight |
98.7 |
Isoelectric point (calc.) |
10.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIRVMGMLDI/LASRILNELKL |
Localization (YFP) |
cytoplasmic dots at
cell tip with filamentous structures; periphery at site of
septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |