| Gene name |
SPBC9B6.02c |
| Gene ID |
34/B01 |
| Gene synonyms/obsolete |
Tf2-9; tf2-8 |
| Gene product |
transposable element;
retrotransposable element |
| Entry clone |
Cloned#/ 3' FS |
| ORF length (unspliced) |
4002 |
| ORF length (spliced) |
|
| Entry clone length |
4002 |
| No. of intron |
0 |
| Sequence status |
planning for
re-cloning |
| Sequence results |
153T:A / 617T:C /
3992T:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC9B6.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTACGCAAATTATCG |
| Rev primer name |
SPBC9B6.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATATTTAGATTATTGTTT |
| Amino acid length |
1333 |
| Molecular weight |
154.9 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |