| Gene name |
SPBC25B2.02c |
| Gene ID |
34/B02 |
| Gene synonyms/obsolete |
mam1;
SPBC2G5.09c |
| Gene product |
ABC transporter
family; MDR subfamily; mating factor; M-factor
transporter |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4011 |
| ORF length (spliced) |
|
| Entry clone length |
4011 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
711T:C / 2699A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC25B2.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCACATTCATTCAGATTT |
| Rev primer name |
SPBC25B2.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCAATCCATTCACCGCGG |
| Amino acid length |
1336 |
| Molecular weight |
150.8 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRWFFLLGL/LVAVSPILCL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |