| Gene name |
SPAC10F6.10 |
| Gene ID |
35/B09 |
| Gene synonyms/obsolete |
|
| Gene product |
protein kinase (RIO
family); RIO1 domain; similar to A. nidulans; SUDD suppressor
of bimD6; chromosome-spindle attachment defect |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1681 |
| ORF length (spliced) |
1566 |
| Entry clone length |
1681 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC10F6.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGAGGAGTTAAAAAA |
| Rev primer name |
SPAC10F6.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTTTTTCTTCCAGATTGT |
| Amino acid length |
521 |
| Molecular weight |
60.2 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
488/509 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNTDFQKLDL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
| Microscope used for
observation |
DeltaVision |