Gene name |
SPCC569.05c |
Gene ID |
35/G04 |
Gene synonyms/obsolete |
|
Gene product |
unknown specificity;
transporter; similar to Sp SPAC11D3.05 and SPCC794.04C and
SPBC530.15C and SPBC36.03C and SPBC36.01C and SPBC36.02C and
SPBC530.02 and SPBC947.06C; involved in amine/polyamine
transport |
Entry clone |
Cloned |
ORF length (unspliced) |
1731 |
ORF length (spliced) |
|
Entry clone length |
1731 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
700G:A / 1184A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC569.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACTAACCCGAATGC |
Rev primer name |
SPCC569.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAATACAACAGCCATCTTG |
Amino acid length |
576 |
Molecular weight |
63.7 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; Golgi? |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |