| Gene name |
SPAC22F3.09c |
| Gene ID |
37/E05 |
| Gene synonyms/obsolete |
pct1; res2; mcs1 |
| Gene product |
DSp1/MBF trancription
factor complex; involved in start control point of mitotic
cell cycle; involved in control of meiotic start; mitotic
catastrophe suppressor; APSES domain; DNA-binding protein;
ankyrin repeat protein; involved in control of mitosis;
partner of Cdc10p transcription factor; ankyrin repeat
protein; similar to Sp SPBC336.12c and SPBC725.16 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2138 |
| ORF length (spliced) |
1974 |
| Entry clone length |
2138 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
935A:G / 1252A:G /
1460A:G / 1598T:C / 2085T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22F3.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTCCACGTTCTTCCGC |
| Rev primer name |
SPAC22F3.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTCTCGGGTTAATGCT |
| Amino acid length |
657 |
| Molecular weight |
73.7 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol; nuclear dots; cytoplasmic
dots |
| Comments for localization |
dots along
microtubules? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |