| Gene name |
SPAC644.12 |
| Gene ID |
38/E01 |
| Gene synonyms/obsolete |
cdc5 |
| Gene product |
transcriptional
regulator; Myb family; DNA binding protein; essential;
involved in mRNA splicing (required); 40S snRNP-containing
complex; involved in G2/M phase progression (required);
depletion causes accumulation of unspliced mRNAs; involved in
nuclear division (required); nineteen complex (Ntc); interacts
physically with Cwf8p (residues 443-515); interacts physically
with Cwf1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2577 |
| ORF length (spliced) |
2274 |
| Entry clone length |
2577 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
2208T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC644.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGTTTTAAAAGGAGG |
| Rev primer name |
SPAC644.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTGTCCAGTAACCCTA |
| Amino acid length |
757 |
| Molecular weight |
86.8 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
197 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
spindle
microtubules |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |