| Gene name |
SPAC17A5.02c |
| Gene ID |
40/F04 |
| Gene synonyms/obsolete |
dbr1 |
| Gene product |
RNA lariat debranching
enzyme; involved in mRNA splicing; involved in mRNA stability;
required for intronic snoRNA biosynthesis; functionally
complemented by human DRB1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1530 |
| ORF length (spliced) |
1401 |
| Entry clone length |
1530 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
328A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17A5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTACTTTGCAAGATT |
| Rev primer name |
SPAC17A5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGTACAATTTCGTTTGGA |
| Amino acid length |
466 |
| Molecular weight |
53.4 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |