| Gene name |
SPCC126.15c |
| Gene ID |
42/G01 |
| Gene synonyms/obsolete |
sec65 |
| Gene product |
protein signal
sequence binding activity; involved in intracellular protein
transport; involved in protein-ER targeting; involved in
SRP-dependent cotranslational membrane targeting |
| Entry clone |
Cloned |
| ORF length (unspliced) |
653 |
| ORF length (spliced) |
600 |
| Entry clone length |
653 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC126.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCATCTATCATATTATA |
| Rev primer name |
SPCC126.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCAAATCCAAATCATAT |
| Amino acid length |
199 |
| Molecular weight |
21.9 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |