| Gene name |
SPAC23H4.14 |
| Gene ID |
47/D12 |
| Gene synonyms/obsolete |
vps39 |
| Gene product |
CNH domain; involved
in intracellular protein transport; involved in vacuole
fusion |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2919 |
| ORF length (spliced) |
2718 |
| Entry clone length |
2919 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23H4.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATAGAGCATTTTCATT |
| Rev primer name |
SPAC23H4.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAGGCTTCATAAGGAAGA |
| Amino acid length |
905 |
| Molecular weight |
103.6 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLYLKRILEL |
| Localization (YFP) |
ambiguous structure;
cytosol=nucleus |
| Comments for localization |
membranous
accumulation around nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |