Gene name |
SPAPB24D3.01 |
Gene ID |
49/C04 |
Gene synonyms/obsolete |
SPAPB2C8.02 |
Gene product |
involved in
transcriptional regulation; zinc finger protein; zf-fungal
Zn(2)-Cys(6) binuclear cluster domain |
Entry clone |
Cloned |
ORF length (unspliced) |
1785 |
ORF length (spliced) |
|
Entry clone length |
1785 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
775T:C / 913T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAP24D3.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCTGTGGAAAAGGC |
Rev primer name |
SPAP24D3.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGTCAAAAAGCTCGCAAAA |
Amino acid length |
594 |
Molecular weight |
68.9 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVSFYSVLAL/LEKIQALLI/LYCPFTPFLVL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |