Gene name |
SPAC1805.15c |
Gene ID |
50/A09 |
Gene synonyms/obsolete |
pub2 |
Gene product |
ubiquitin-protein
ligase (E2); HECT domain; WW domain; C2 domain; constitutively
expressed; function overlapping with Pub1p; post-translational
modification, Cys639 can be thiol-ubiquitinated; similar to Sp
SPBC16E9.11C and SPAC11G7.02 |
Entry clone |
Cloned |
ORF length (unspliced) |
2209 |
ORF length (spliced) |
2016 |
Entry clone length |
2209 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1805.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAATATTCGCTTTGA |
Rev primer name |
SPAC1805.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCCGTACCAAATCCTGCA |
Amino acid length |
671 |
Molecular weight |
77.1 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLRSLKPYLLI |
Localization (YFP) |
periphery;
nucleus>cytosol; cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |