| Gene name |
SPCC1742.01 |
| Gene ID |
50/A12 |
| Gene synonyms/obsolete |
SPCPB16A4.07c;
SPCC1795.13 |
| Gene product |
hypothetical protein;
possibly Sp specific; GPI anchored protein (pers. comm. Birgit
Eisenhaber); glycoprotein; no apparent Sc ortholog; large
repeated threonine-rich region; 4 Tryp_mucin |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
4692 |
| ORF length (spliced) |
|
| Entry clone length |
4692 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPCC1742.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTTAGAAGGTTTTT |
| Rev primer name |
SPCC1742.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATTAGAGTAACAATATAT |
| Amino acid length |
1563 |
| Molecular weight |
157.6 |
| Isoelectric point (calc.) |
3.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|