Gene name |
SPAPB1A10.07c |
Gene ID |
50/F07 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
TMS membrane protein/ tumour differentially expressed protein
(TDE) domain |
Entry clone |
Cloned |
ORF length (unspliced) |
1375 |
ORF length (spliced) |
1326 |
Entry clone length |
1375 |
No. of intron |
1 |
Sequence status |
Partially
sequenced |
Sequence results |
#Low sequence
quality |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB1A10.07.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGGTGCGGTTTTATCTAT |
Rev primer name |
SPAPB1A10.07.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAATCATGAAGCGATAAGGA |
Amino acid length |
441 |
Molecular weight |
49 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFIVYGLML |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |